Give it a transcript and a range. It blows out every variant. 전사체와 구간만 주세요. 가능한 변이를 전부 뿜어냅니다.

VCFART reads HGVS ranges such as c.5075-100_c.5152+100, follows the transcript on your hg19 or hg38 FASTA, and writes every SNV, indel or codon swap as a sorted, normalized VCF that SpliceAI, ANNOVAR and VEP take as is.

VCFART는 c.5075-100_c.5152+100 같은 HGVS 구간을 읽고, hg19·hg38 FASTA 위에서 전사체를 따라가며, 가능한 모든 SNV·indel·코돈 치환을 정렬·정규화된 VCF로 씁니다. SpliceAI, ANNOVAR, VEP에 그대로 넣으면 됩니다.

python -m pip install vcfart

Source on GitHubGitHub에서 보기

Hover a cell, or tab into the map and use the arrow keys.칸 위에 마우스를 올리거나, Tab으로 들어가 화살표 키로 움직여 보세요.

HGVS c.
HGVS p.
Consequence
VCF recordVCF 레코드

splice site, stop gained, start or stop lostsplice site, stop gained, start/stop lost
missensemissense
splice regionsplice region
synonymous동의 변이
intron, UTR인트론, UTR
reference basereference 염기

What a run looks like실행하면 이렇게 나옵니다

Every step is logged with what it found, and the consequences come back as a coloured bar chart before the files are written. Colour switches off when you pipe the output or set NO_COLOR.단계마다 찾은 내용을 보여주고, 파일을 쓰기 전에 consequence 분포를 색깔 막대그래프로 보여줍니다. 출력을 파이프로 넘기거나 NO_COLOR를 설정하면 색은 꺼집니다.

$ vcfart generate -f demo.fa -a demo_refGene.txt -t NM_DEMO.1 -r ex3=exon3:30 -m snv,del,ins -o out/demo_ex3
 ██╗   ██╗ ██████╗███████╗ █████╗ ██████╗ ████████╗
 ██║   ██║██╔════╝██╔════╝██╔══██╗██╔══██╗╚══██╔══╝
 ██║   ██║██║     █████╗  ███████║██████╔╝   ██║
 ╚██╗ ██╔╝██║     ██╔══╝  ██╔══██║██╔══██╗   ██║
  ╚████╔╝ ╚██████╗██║     ██║  ██║██║  ██║   ██║
   ╚═══╝   ╚═════╝╚═╝     ╚═╝  ╚═╝╚═╝  ╚═╝   ╚═╝
   💨 뿌뿡  artificial VCFs for MAVE / SGE / DMS   v1.0.0

   reference | 🧬 demo.fa
  annotation | 📚 demo_refGene.txt
  transcript | 📍 NM_DEMO.1 DEMO1  chrDemo:501-2,843 (-)  5 exons  CDS 603 bp
      region | 🎯 ex3  c.181-30_342+30  chrDemo:1,752-1,973  222 bp  intron2 → intron3
    generate | 💨 1,772 raw edits → 1,487 unique variants
       types | 🧪 SNV 666   INS 664   DEL 157
 consequence | 📊 frameshift_variant                  ██████████████████████ 581
             |    missense_variant                    █████████████ 348
             |    intron_variant                      █████████ 227
             |    synonymous_variant                  ████ 118
             |    splice_region_variant               ███ 87
             |    splice_polypyrimidine_tract_variant ██ 56
             |    stop_gained                         █ 38
             |    splice_donor_variant                █ 11
             |    splice_acceptor_variant             █ 11
             |    splice_donor_5th_base_variant       █ 10
       write | 💾 out/demo_ex3.vcf
             | 💾 out/demo_ex3.tsv

  💨 뿌뿡!  1,487 variants → out/demo_ex3.vcf

What comes out출력 파일

Three plain-text files per run. The lines below are copied unedited from the run shown above, on the demo gene bundled in examples/.실행할 때마다 텍스트 파일 세 개가 나옵니다. 아래 줄들은 위 터미널 화면의 실행(examples/에 들어 있는 demo 유전자)에서 그대로 가져왔습니다.

PREFIX.vcf

Every variant, sorted and left-normalized, REF checked against your FASTA. The ID column carries the c. description.

모든 변이를 정렬하고 left-normalize하며, REF는 FASTA로 확인합니다. ID 열에 c. 표기가 들어갑니다.

#CHROM  POS   ID          REF ALT ... INFO
chrDemo 1944  c.181-1G>A  C   T   ... VA_HGVSc=c.181-1G>A;VA_CSQ=splice_acceptor_variant&intron_variant;
                                    VA_REGION=intron2;VA_TYPE=SNV;VA_ORIGIN=snv;VA_SET=ex3

PREFIX.tsv

One row per variant: HGVS c., predicted HGVS p., consequence, exon or intron, and which range produced it.

변이 한 줄씩: HGVS c., 예측 HGVS p., consequence, 엑손/인트론 위치, 어느 구간에서 나왔는지.

set  pos   ref alt hgvs_c                 hgvs_p      consequence       region
ex3  1936  G   A   NM_DEMO.1:c.188C>T     p.Pro63Leu  missense_variant  exon3

PREFIX.oligos.fa

With --oligo: the mutant window for each variant in transcript orientation, with your adapters attached.

--oligo를 주면: 변이마다 transcript 방향의 mutant 서열, 어댑터까지 붙여서.

>ex3|WT
…CTTTTCCTTTTTTTTCTCCAGACAACCCCCCCCATTTACGA…
>ex3|c.181-1G>A
…CTTTTCCTTTTTTTTCTCCAAACAACCCCCCCCATTTACGA…

Ranges, written the way you already write them구간은 평소 쓰던 대로

BRCA1, NM_007294.4, hg38. Exon numbers follow the transcript model in your annotation file.BRCA1, NM_007294.4, hg38 기준. 엑손 번호는 annotation 파일의 전사체 모델을 따릅니다.

You type입력	VCFART readsVCFART가 읽는 구간
`-r c.5075-100_c.5152+100`	chr17:43,063,774–43,064,051 (278 bp: intron 16, exon 17, intron 17)(278 bp: 인트론 16, 엑손 17, 인트론 17)
`-r exon17:100`	the same 278 bp: exon 17 plus 100 bp on each side같은 278 bp: 엑손 17 + 양쪽 100 bp
`-r int16=c.5075-100_c.5075-1`	the 3′ end of intron 16, labelled `int16` in the output인트론 16의 3′ 끝, 출력에 `int16` 라벨로 표시
`-r c.5075-1`	chr17:43,063,952 (the splice acceptor of exon 17)(엑손 17의 splice acceptor)
`-r cds --exonic-only`	every coding base from c.1 to the stop codon, introns left outc.1부터 stop codon까지 코딩 염기만, 인트론 제외

Four ways to mutate변이를 만드는 네 가지 방법

Combine them in one run, for example -m snv,del,codon. Variants that are the same at the sequence level are written once.한 번에 섞어 쓸 수 있습니다(예: -m snv,del,codon). 서열상 같은 변이는 한 번만 기록됩니다.

-m snv: All three alternative bases at every position. This is the default.모든 위치에서 나머지 염기 3개로 치환합니다. 기본값입니다.
-m del --del-sizes 1,3: Deletions of the lengths you list. Deleting any C of a CCCCCC run gives one record, named by the 3′ rule.지정한 길이의 결실. CCCCCC 중 어느 C를 지워도 한 줄로 합쳐지고, 3′ rule로 이름 붙습니다.
-m ins --ins-sizes 1: Every k-mer inserted between every pair of bases. Insertions that copy the neighbouring sequence are reported as dup.모든 염기 사이에 가능한 모든 k-mer 삽입. 옆 서열을 복제하는 삽입은 dup으로 표기됩니다.
-m codon: Deep-mutational-scanning codon swaps: one codon per amino acid plus Ter and a synonymous control, all 63 codons, or NNK.DMS 방식 코돈 치환: 아미노산마다 코돈 하나 + Ter + 동의 코돈 대조군, 63개 전부, 또는 NNK.

Checked against real data실제 데이터로 검증

Run on hg38 with the ANNOVAR hg38_refGene.txt transcript table.hg38과 ANNOVAR hg38_refGene.txt 전사체 테이블로 실행했습니다.

Target대상	Variants변이 수	Result결과
444-bp intron–exon–intron target, minus-strand gene444 bp 인트론–엑손–인트론 구간, minus strand 유전자	1,332 SNVs	Positions, alleles and c. labels identical to the authors’ original in-house MAVE scripts기존 in-house MAVE 스크립트와 위치, 염기, c. 표기 모두 동일
DRC1 coding sequence, NM_145038, plus strandDRC1 코딩 서열, NM_145038, plus strand	6,669 SNVs	c. and p. identical to ANNOVAR refGene for all 6,669, including start and stop changes6,669개 전부 ANNOVAR refGene과 c./p. 일치(start·stop 변화 포함)
Test suite: synthetic genes on both strands, indel normalization, protein edge cases테스트: 양쪽 strand 합성 유전자, indel 정규화, 단백질 예외 사례	49 tests	All pass모두 통과

Start in four commands명령 네 개로 시작하기

Python 3.9 or newer, nothing else to install. Your FASTA gets a .fai index on first use if it has none.Python 3.9 이상이면 끝, 다른 설치는 없습니다. FASTA에 .fai가 없으면 처음 실행할 때 만듭니다.

Install설치
```
python -m pip install vcfart
```

Look up the transcript전사체 확인

vcfart info -f hg38.fa -a humandb/hg38_refGene.txt -t NM_007294.4

Generate the variants변이 생성

vcfart generate -f hg38.fa -a humandb/hg38_refGene.txt -t NM_007294.4 \
    -r exon17:100 -m snv,del -o BRCA1_ex17

Score them점수 매기기

spliceai -I BRCA1_ex17.vcf -O BRCA1_ex17.spliceai.vcf -R hg38.fa -A grch38

Give it a transcript and a range. It blows out every variant. 💨 전사체와 구간만 주세요. 가능한 변이를 전부 뿜어냅니다. 💨

🖥️What a run looks like실행하면 이렇게 나옵니다

📦What comes out출력 파일